Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Addgene is open for ordering and depositing; find up-to-date details here. To learn more about how we are supporting COVID-19 research and to find related plasmids, check out our COVID-19 and Coronavirus Plasmids & Resources page.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pcDNA5/FRT/TO-GAlphaoA-RLuc8
(Plasmid #140976)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 140976 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pcDNA5/FRT/TO
  • Backbone manufacturer
    Invitrogen
  • Backbone size w/o insert (bp) 5189
  • Vector type
    Mammalian Expression, Luciferase

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    GAlphaoA-RLuc8
  • Alt name
    GNAO1 (Isoform Alpha-1)
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    2034
  • Mutation
    RLuc8 and flanking SGGGGS linkers have been inserted at amino acid position 92 of the alpha subunit
  • Entrez Gene
    GNAO1 (a.k.a. EIEE17, G-ALPHA-o, GNAO, HLA-DQB1, NEDIM)
  • Promoter CMV

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer TAGAAGGCACAGTCGAGG
  • (Common Sequencing Primers)

Resource Information

  • Terms and Licenses
  • Industry Terms
    • Not Available to Industry

Depositor Comments

During QC NGS analysis, Addgene identified a sequence discrepancy in the hygromycin resistance gene. This gene may not be functional.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pcDNA5/FRT/TO-GAlphaoA-RLuc8 was a gift from Bryan Roth (Addgene plasmid # 140976 ; http://n2t.net/addgene:140976 ; RRID:Addgene_140976)
  • For your References section:

    TRUPATH, an open-source biosensor platform for interrogating the GPCR transducerome. Olsen RHJ, DiBerto JF, English JG, Glaudin AM, Krumm BE, Slocum ST, Che T, Gavin AC, McCorvy JD, Roth BL, Strachan RT. Nat Chem Biol. 2020 May 4. pii: 10.1038/s41589-020-0535-8. doi: 10.1038/s41589-020-0535-8. 10.1038/s41589-020-0535-8 PubMed 32367019