pUAP1_Ta_Yr7_CDS_no_STOP
(Plasmid #141093)

• Purpose: Level 0 Golden gate module with the coding sequence of Cadenza-Yr7 without its STOP codon
• Depositing Lab: Cristobal Uauy
• Publication: Marchal et al Genes (Basel). 2020 Nov 26;11(12). pii: genes11121406. doi: 10.3390/genes11121406.

Backbone

• Vector backbone: pUAP1 (Addgene #63674)
• Backbone size w/o insert (bp): 3138
• Total vector size (bp): 6815
• Vector type: Unspecified ; Level 0 module for Golden Gate cloning (AATG - TTCG overhangs)

Growth in Bacteria

• Bacterial Resistance(s): Chloramphenicol, 25 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Ta_Yr7
• Species: Triticum aestivum cv. Cadenza
• Insert Size (bp): 4758
• GenBank ID: MN273771.1

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BpiI (unknown if destroyed)
• 3′ cloning site: BpiI (unknown if destroyed)
• 5′ sequencing primer: AAGTTGGAACCTCTTACGTGC
• 3′ sequencing primer: AACCGTATTACCGCCTTTGA

Resource Information

• Supplemental Documents:
  • Yr7_CDS_oh-tag-in_pUAP1.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry