Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

pTXB1-Tn5
(Plasmid #60240)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 60240 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pTXB1
  • Backbone manufacturer
    New England Biolabs
  • Backbone size w/o insert (bp) 6706
  • Total vector size (bp) 8079
  • Modifications to backbone
    None
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    XL1 Blue
  • Growth instructions
    Growth at 37°C before IPTG induction. After IPTG addition, grow at 30°C. The depositing laboratory recommends E. coli strains NEB C3013 or ER2566 for protein expression.
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    tnpA from pBam1
  • Alt name
    Tn5 transposase
  • Species
    E. coli
  • Insert Size (bp)
    1428
  • Mutation
    E54K, L372P
  • GenBank ID
    HQ908071.1
  • Promoter T7 promoter
  • Tag / Fusion Protein
    • Mxe intein - Chitin-binding domain (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Xba (not destroyed)
  • 3′ cloning site Lgu1/SapI) (destroyed during cloning)
  • 5′ sequencing primer T7 promoter primer
  • 3′ sequencing primer GATTGCCATGCCGGTCAAGG
  • (Common Sequencing Primers)

Resource Information

  • Addgene Notes
  • A portion of this plasmid was derived from a plasmid made by
    Tn5 transposase from pBAM1 (Addgene Plasmid #60487)
  • Articles Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pTXB1-Tn5 was a gift from Rickard Sandberg (Addgene plasmid # 60240 ; http://n2t.net/addgene:60240 ; RRID:Addgene_60240)
  • For your References section:

    Tn5 transposase and tagmentation procedures for massively-scaled sequencing projects. Picelli S, Bjorklund AK, Reinius B, Sagasser S, Winberg G, Sandberg R. Genome Res. 2014 Jul 30. pii: gr.177881.114. 10.1101/gr.177881.114 PubMed 25079858