Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

FCK-hCmC
(Plasmid #14897)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 14897 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    FCK(1.3)GW
  • Backbone manufacturer
    Pavel Osten
  • Backbone size w/o insert (bp) 9250
  • Vector type
    Mammalian Expression, Bacterial Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Growth instructions
    Use recombinase-free E. coli (e.g., Invitrogen's Stbl3)
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    ChR2
  • Alt name
    Channelrhodopsin-2
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1650
  • Tag / Fusion Protein
    • mCherry (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer atgactgagaccctcccacccgtgactgaaagcgccgt
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Created with Dr. Karl Deisseroth at Stanford.

Channelrhodopsin-2/ChR2, with humanized/mammalian optimized codon usage, fused with mCherry (FCK-hCmC), containing hChR2-mCherry. Please note that the mCherry signal is faint.

For more information, see http://channelrhodopsin.org

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    FCK-hCmC was a gift from Edward Boyden (Addgene plasmid # 14897)