SPDK3889(TRV-RNA2-pPEBV-MCS-AtMet-tRNA)
(Plasmid
#149277)
-
PurposeModified Tobacco rattle virus RNA2 vector that could be used for expression of sgRNAs
-
Depositing Lab
-
Depositing OrganizationUniversity of California, Davis
Located in the United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 149277 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 149277-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 149277-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepCAMBIA0390 T-DNA vector
- Backbone size w/o insert (bp) 6426
- Total vector size (bp) 9649
-
Vector typeT-DNA vector
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsWe prefer to use DH10B
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameModified TRV RNA2 with PEBV promoter and AtMet-tRNA mobile RNA sequence
-
SpeciesModified TRV RNA2 with PEBV promoter and AtMet-tRNA mobile RNA sequence
-
Insert Size (bp)2092
-
MutationT2318C (DNA) in PEBV coat protein sequence
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XbaI, StuI, BamHI, KpnI, SacI (not destroyed)
- 3′ cloning site None (unknown if destroyed)
- 5′ sequencing primer CATAATTATACTGATTTGTCTCTCG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 149277-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 149277-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
SPDK3889(TRV-RNA2-pPEBV-MCS-AtMet-tRNA) was a gift from Savithramma Dinesh-Kumar (Addgene plasmid # 149277 ; http://n2t.net/addgene:149277 ; RRID:Addgene_149277) -
For your References section:
Multiplexed heritable gene editing using RNA viruses and mobile single guide RNAs. Ellison EE, Nagalakshmi U, Gamo ME, Huang PJ, Dinesh-Kumar S, Voytas DF. Nat Plants. 2020 Jun 1. pii: 10.1038/s41477-020-0670-y. doi: 10.1038/s41477-020-0670-y. 10.1038/s41477-020-0670-y PubMed 32483329