Skip to main content

SPDK3902(TRV-RNA2-pPEBV-MCS-AtGly-tRNA)
(Plasmid #149278)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 149278 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 149278-D50 50 μg of DNA in Tris buffer $495
DNA 149278-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pCAMBIA0390 T-DNA vector
  • Backbone size w/o insert (bp) 6426
  • Total vector size (bp) 9648
  • Vector type
    T-DNA vector

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    We prefer to use DH10B cells
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Modified TRV RNA2 with PEBV promoter and AtGly-tRNA mobile RNA sequence
  • Species
    Modified TRV RNA2 with PEBV promoter and AtGly-tRNA mobile RNA sequence
  • Insert Size (bp)
    2091
  • Mutation
    T2318C (DNA) in PEBV coat protein sequence

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XbaI, StuI, BamHI, KpnI, SacI (not destroyed)
  • 3′ cloning site None (unknown if destroyed)
  • 5′ sequencing primer CATAATTATACTGATTTGTCTCTCG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    SPDK3902(TRV-RNA2-pPEBV-MCS-AtGly-tRNA) was a gift from Savithramma Dinesh-Kumar (Addgene plasmid # 149278 ; http://n2t.net/addgene:149278 ; RRID:Addgene_149278)
  • For your References section:

    Multiplexed heritable gene editing using RNA viruses and mobile single guide RNAs. Ellison EE, Nagalakshmi U, Gamo ME, Huang PJ, Dinesh-Kumar S, Voytas DF. Nat Plants. 2020 Jun 1. pii: 10.1038/s41477-020-0670-y. doi: 10.1038/s41477-020-0670-y. 10.1038/s41477-020-0670-y PubMed 32483329