-
Depositing Lab
-
Depositing OrganizationHarvard University
Located in the United States of America -
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 14945 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 14945-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 14945-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepGL2 basic
-
Backbone manufacturerPromega
- Backbone size w/o insert (bp) 5597
-
Vector typeMammalian Expression, Luciferase
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameLDLR promoter mut SRE
-
Alt nameLDL receptor promoter
-
Alt nameLDL receptor
-
SpeciesH. sapiens (human)
-
Insert Size (bp)340
-
MutationPoint mutation in the SRE-1 sequence of the LDL receptor promoter (ATCACCCCAC changed to ATAACCCCAC)
-
GenBank IDNC_000019
-
Entrez GeneLDLR (a.k.a. FH, FHC, FHCL1, LDLCQ2)
-
Tag
/ Fusion Protein
- luciferase (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SacI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer n/a
- 3′ sequencing primer LucNrev
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Primers used for site-directed mutagenesis: 5'- ggtgaagacatttgaaaataaccccactgcaaactcc -3' and 5'-GGAGTTTGCAGTGGGGTTATTTTCAAATGTCTTCACC -3'
DNA (Catalog # 14945-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 14945-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLDLR-Luc mutSRE was a gift from Axel Nohturfft (Addgene plasmid # 14945 ; http://n2t.net/addgene:14945 ; RRID:Addgene_14945) -
For your References section:
Transcriptional regulation of phagocytosis-induced membrane biogenesis by sterol regulatory element binding proteins. Castoreno AB, Wang Y, Stockinger W, Jarzylo LA, Du H, Pagnon JC, Shieh EC, Nohturfft A. Proc Natl Acad Sci U S A. 2005 Sep 13. 102(37):13129-34. 10.1073/pnas.0506716102 PubMed 16141315