Skip to main content

pNICE-NL2(-)
(Plasmid #15246)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 15246 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 15246-D50 50 μg of DNA in Tris buffer $495
DNA 15246-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pNICE
  • Backbone size w/o insert (bp) 4014
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Neuroligin 2(-)
  • Alt name
    Nlgn2(-)
  • Alt name
    Nlgn2
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    2586
  • GenBank ID
    NM_198862
  • Entrez Gene
    Nlgn2 (a.k.a. NL2, NLG2)
  • Tag / Fusion Protein
    • HA (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ sequencing primer cgcaaatgggcggtaggcgtgt
  • 3′ sequencing primer aagcaagtaaaacctctacaaatg
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    NL2(-) cDNA clone is from Invitrogen

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pNICE-NL2(-) was a gift from Peter Scheiffele (Addgene plasmid # 15246 ; http://n2t.net/addgene:15246 ; RRID:Addgene_15246)
  • For your References section:

    Alternative splicing controls selective trans-synaptic interactions of the neuroligin-neurexin complex. Chih B, Gollan L, Scheiffele P. Neuron. 2006 Jul 20. 51(2):171-8. 10.1016/j.neuron.2006.06.005 PubMed 16846852

Ready-to-use antibodies

Looking for antibodies related to this plasmid? Check out this option:

Learn More