-
Depositing Lab
-
Depositing OrganizationColumbia University
Located in United States of America -
Publication
-
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 15246 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 15246-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 15246-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepNICE
- Backbone size w/o insert (bp) 4014
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameNeuroligin 2(-)
-
Alt nameNlgn2(-)
-
Alt nameNlgn2
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)2586
-
GenBank IDNM_198862
-
Entrez GeneNlgn2 (a.k.a. NL2, NLG2)
-
Tag
/ Fusion Protein
- HA (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ sequencing primer cgcaaatgggcggtaggcgtgt
- 3′ sequencing primer aagcaagtaaaacctctacaaatg
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byNL2(-) cDNA clone is from Invitrogen
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 15246-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 15246-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pNICE-NL2(-) was a gift from Peter Scheiffele (Addgene plasmid # 15246 ; http://n2t.net/addgene:15246 ; RRID:Addgene_15246) -
For your References section:
Alternative splicing controls selective trans-synaptic interactions of the neuroligin-neurexin complex. Chih B, Gollan L, Scheiffele P. Neuron. 2006 Jul 20. 51(2):171-8. 10.1016/j.neuron.2006.06.005 PubMed 16846852