pSH1/Mf-del-Akt-E
(Plasmid
#15288)
-
Depositing Lab
-
Depositing OrganizationBaylor College of Medicine
Located in United States of America -
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 15288 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepSH1
-
Backbone manufacturerGR Crabtree lab
- Backbone size w/o insert (bp) 3500
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namedelPH-Akt
-
Alt namePKB
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)1240
-
MutationTruncated PH (residues 1-99)
-
Entrez GeneAkt1 (a.k.a. Akt, LTR-akt, PKB, PKB/Akt, PKBalpha, Rac)
-
Tags
/ Fusion Proteins
- HA epitope (C terminal on insert)
- Myristoylation-targeting domain Fyn (16aa) (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NotI, SacII (not destroyed)
- 3′ cloning site EcoRI, BamHI (not destroyed)
- 5′ sequencing primer gaggtgttacttctgctctaaaagc
- 3′ sequencing primer cactgcattctagttgtggtttg
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSH1/Mf-del-Akt-E was a gift from David Spencer (Addgene plasmid # 15288 ; http://n2t.net/addgene:15288 ; RRID:Addgene_15288) -
For your References section:
An essential role for Akt1 in dendritic cell function and tumor immunotherapy. Park D, Lapteva N, Seethammagari M, Slawin KM, Spencer DM. Nat Biotechnol. 2006 Dec . 24(12):1581-90. 10.1038/nbt1262 PubMed 17143278