Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

pSH1/M-FRBl2-E
(Plasmid #15289)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 15289 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pSH1
  • Backbone manufacturer
    GR Crabtree lab
  • Backbone size w/o insert (bp) 3500
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    FRAP-rapamycin binding domain
  • Alt name
    mTOR
  • Alt name
    RAFT
  • Alt name
    FRAP
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    630
  • Mutation
    res. 2025-2113, T2098L
  • Entrez Gene
    MTOR (a.k.a. FRAP, FRAP1, FRAP2, RAFT1, RAPT1, SKS)
  • Tags / Fusion Proteins
    • HA epitope (C terminal on insert)
    • Myristoylation-targeting domain c-Src (14aa) (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NotI, SacII (not destroyed)
  • 3′ cloning site EcoRI, BamHI (not destroyed)
  • 5′ sequencing primer gaggtgttacttctgctctaaaagc
  • 3′ sequencing primer cactgcattctagttgtggtttg
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSH1/M-FRBl2-E was a gift from David Spencer (Addgene plasmid # 15289 ; http://n2t.net/addgene:15289 ; RRID:Addgene_15289)
  • For your References section:

    A novel conditional Akt 'survival switch' reversibly protects cells from apoptosis. Li B, Desai SA, MacCorkle-Chosnek RA, Fan L, Spencer DM. Gene Ther. 2002 Feb . 9(4):233-44. 10.1038/sj.gt.3301641 PubMed 11896462