pET303-colE1T
(Plasmid #155180)

• Purpose: Expresses colicin E1 residues 1-190
• Depositing Lab: Joanna Slusky
• Publication: Budiardjo et al Elife. 2022 Feb 24;11. pii: 73297. doi: 10.7554/eLife.73297.

Backbone

• Vector backbone: pET303
• Backbone manufacturer: Invitrogen
• Backbone size w/o insert (bp): 5343
• Total vector size (bp): 5937
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: colicin E1 residues 1-190
• Species: E. coli
• Insert Size (bp): 594
• Mutation: truncation of colicin E1 including 1-190
• GenBank ID: AAA59418.1
• Promoter: T7
• Tag / Fusion Protein:
  • C-terminal 6x Histidine tag (C terminal on backbone)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: TAATACGACTCACTATAGGG
• 3′ sequencing primer: GCTAGTTATTGCTCAGCGG

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please visit https://doi.org/10.1101/692251 for bioRxiv preprint.