Skip to main content

pMBPcyto-TEV-BseRI
(Plasmid #157739)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 157739 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    pET PPL His6 MBP LIC cloning vector (2K-T) = Addgene #37183
  • Backbone size (bp) 5942
  • Modifications to backbone
    none
  • Vector type
    Bacterial Expression
  • Promoter T7
  • Tag / Fusion Protein
    • His10 + MBP (cytoplasmic expression; no signal sequence) (N terminal on backbone)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer GAAAGGTGAAATCATGCCGAACATC
  • 3′ sequencing primer CTTCCTTTCGGGCTTTGTTAGC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

- Empty vector for cytoplasmic expression of N-terminally His10+MBP-tagged protein of interest, where tag removal by TEV protease yields the native sequence for the protein of interest.
- Based on plasmid pET PPL His6 MBP LIC cloning vector (2K-T) (Plasmid #37183), but has the added advantage in leaving no added amino acid residues following cleavage with TEV protease. This advantage is made possible by cloning into the two BseRI restriction sites.
- Subcloning requires ligation-independent cloning and use of the two BseRI restriction sites that are present in this empty vector. The two BseRI sites span a removable 432 nucleotide sequence. Cloning into the BseRI-digested vector can be achieved using a ligation-independent system that is dependent on homologous recombination, such as the Takara In-Fusion HD Cloning Plus system, which requires simply designing the PCR-derived insert (containing the protein of interest) to contain 15 bp at each end that matches the 15 bp at each end of the linearized parent vector. In other words, add these 15 bp, AACCTGTACTTCCAA, to the 5' end of the PCR FORWARD primer, and add these 15 bp, CGCGATCGCGGATCC, to the 5' end of the PCR REVERSE primer.
- The sequence of the added N-terminus is MKSS + His10 + GSSM + maltose binding protein (aa K27-T392 of NP_290668) + NSSSNNNNNNNNNNLGIE + ENLYFQ*X, where * is the TEV protease cleavage site and X is the N-terminal residue of the introduced protein of interest. Note that TEV protease cleaves most efficiently when X = S, G, A, M; for other compatible residues see Kapust et al 2002, PMID 12074568.
- The maltose binding protein tag is the mature form, without its signal sequence, therefore protein expression is directed to the cytoplasm.
- BseRI cuts 8-10 nucleotides outside of its own recognition sequence and is a non-palindromic site. The placement & orientation of the two BseRI sites eliminates all of the BseRI recognition sequence in the resulting subclone.
- To verify the PCR-generated insert sequence, use sequencing primers MBPpelBseqF (GAAAGGTGAAATCATGCCGAACATC), and pET-PPLseq1R (CTTCCTTTCGGGCTTTGTTAGC) or T7-Ter (GCTAGTTATTGCTCAGCGG).

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMBPcyto-TEV-BseRI was a gift from Debra Hansen (Addgene plasmid # 157739 ; http://n2t.net/addgene:157739 ; RRID:Addgene_157739)