pelBHisTEV
(Plasmid
#157741)
-
Purpose(Empty Backbone) empty vector; TEV-protease-removable N-term PelB signal sequence +His10; potential C-term His6; T7lac promoter; Kan-R; avoids added residues in final protein since cloning uses BseRI restriction sites
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 157741 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepelB-MBP (DNASU access. no. EvNO00813783)
- Backbone size (bp) 5401
-
Modifications to backbonenone
-
Vector typeBacterial Expression
- Promoter T7lac
-
Tags
/ Fusion Proteins
- PelB signal sequence + His10-tag + TEV protease cleavage site (N terminal on backbone)
- possible His6-tag (adds LEHHHHHH) if no stop codon is added to the cloned insert (C terminal on backbone)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer GCTAGTTATTGCTCAGCGG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
- Empty vector (kanamycin-R) adds TEV-protease-removable N-terminal PelB signal sequence + His10, plus potential C-term His6. Non-leaky expression due to T7lac promoter.
- Has an advantage in leaving no added amino acid residues following TEV protease cleavage of PelB signal sequence + His10. This advantage is made possible by cloning into the two BseRI restriction sites.
- Subcloning requires ligation-independent cloning and use of the two BseRI restriction sites that are present in this empty vector. The two BseRI sites span a removable 432 nucleotide sequence. Cloning into the BseRI-digested vector can be achieved using a ligation-independent system that is dependent on homologous recombination, such as the Takara In-Fusion HD Cloning Plus system, which requires simply designing the PCR-derived insert (containing the protein of interest) to contain 15 bp at each end that matches the 15 bp at each end of the linearized parent vector. In other words, add these 15 bp, AACCTGTACTTCCAA, to the 5' end of the PCR FORWARD primer, and add these 15 bp, GTGGTGGTGCTCGAG, to the 5' end of the PCR REVERSE primer.
- The sequence of the added N-terminus is the PelB signal sequence (M1-A22 of GenBank #AAA24848) + 13 aa linker + His10-tag + 4 aa linker + TEV protease cleavage site. The N-terminal protein sequence is: MKYLLPTAAAGLLLLAAQPAMA + MDIGINSDPNSSS + HHHHHHHHHH + PMGS + ENLYFQ*X, where * is the TEV protease cleavage site and X is the N-terminal residue of the introduced protein of interest. Note that TEV protease cleaves most efficiently when X = S, G, A, M; for other compatible residues see Kapust et al 2002, PMID 12074568.
- A C-terminal His6-tag is possible: if no stop codon is included in the cloned insert, the sequence LEHHHHHH is added to the C-terminus.
- The PelB signal sequence directs the protein of interest to the E. coli inner membrane. Whether the protein traverses the inner membrane is dependent on the protein of interest.
- BseRI cuts 8-10 nucleotides outside of its own recognition sequence and is a non-palindromic site. The placement & orientation of the two BseRI sites eliminates all of the BseRI recognition sequence in the resulting subclone.
- To verify the PCR-generated insert sequence, use sequencing primers T7 (TAATACGACTCACTATAGGG), T7-Ter (GCTAGTTATTGCTCAGCGG).
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pelBHisTEV was a gift from Debra Hansen (Addgene plasmid # 157741 ; http://n2t.net/addgene:157741 ; RRID:Addgene_157741)