pTRE3G-EGFPC-uL10-(Neo)R
(Plasmid #158069)

• Purpose: eGFP and uL10 ribosomal protein under the TRE3G promoter, Neo resistance
• Depositing Lab: Adolfo Rivero-Muller
• Depositing Organization: Medical University of Lublin
  Located in Poland
• Publication: Michalec-Wawiorka et al Int J Mol Sci. 2021 May 14;22(10). pii: ijms22105206. doi: 10.3390/ijms22105206.

Backbone

• Vector backbone: pTRE3G-IRES
• Backbone manufacturer: Clontech Laboratories, Inc. A Takara Bio Compa
• Backbone size w/o insert (bp): 4026
• Total vector size (bp): 6487
• Modifications to backbone: 1. Insertion of sequence encoding human ribosomal protein uL10 with N-terminal fusion of EGFP 2.Replacement of Amp resistance cassette with Neo/Kan resistance cassette
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: RPLP0
• Alt name: uL10, P0; LP0; L10E; RPP0; PRLP0
• Species: H. sapiens (human)
• Insert Size (bp): 984
• GenBank ID: 6175
• Entrez Gene: RPLP0 (a.k.a. L10E, LP0, P0, PRLP0, RPP0, uL10)
• Promoter: TRE3G
• Tag / Fusion Protein:
  • eGFP (N terminal on backbone)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: GCAGAGCTCGTTTAGTGAACC

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Tet Systems Limited Use Label License
• Industry Terms:
  • Not Available to Industry

DNA (Catalog # 158069-D50)

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

• Amount: 50 μg
• Concentration: 1 μg/μL
• Pricing: $495 USD
• Storage: 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Tet Systems Limited Use Label License
• Industry Terms:
  • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

DNA (Catalog # 158069-D100)

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

• Amount: 100 μg
• Concentration: 1 μg/μL
• Pricing: $585 USD
• Storage: 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Tet Systems Limited Use Label License
• Industry Terms:
  • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.