Skip to main content

pCMV3TAG8li-hRNF160-3FLAG
(Plasmid #159138)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 159138 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 159138-D50 50 μg of DNA in Tris buffer $495
DNA 159138-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pCMV-3Tag-8
  • Backbone manufacturer
    Stratagene
  • Backbone size w/o insert (bp) 5200
  • Modifications to backbone
    MCS replaced with new restriction sites: XhoI, HindIII, BamHI, NotI, ClaI
  • Vector type
    Mammalian Expression
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    listerin E3 ubiquitin protein ligase 1
  • Alt name
    LTN1; RNF160; ZNF294; C21orf10; C21orf98
  • Species
    H. sapiens (human)
  • Entrez Gene
    LTN1 (a.k.a. C21orf10, C21orf98, RNF160, ZNF294)
  • Promoter CMV
  • Tag / Fusion Protein
    • 3xFLAG (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (unknown if destroyed)
  • 3′ cloning site ClaI (unknown if destroyed)
  • 5′ sequencing primer AGCTGGTTTAGTGAACCGTCAGATC
  • 3′ sequencing primer TAATACGACTCACTATAGGG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCMV3TAG8li-hRNF160-3FLAG was a gift from Martin Dorf (Addgene plasmid # 159138 ; http://n2t.net/addgene:159138 ; RRID:Addgene_159138)
  • For your References section:

    Mapping a dynamic innate immunity protein interaction network regulating type I interferon production. Li S, Wang L, Berman M, Kong YY, Dorf ME. Immunity. 2011 Sep 23;35(3):426-40. Epub 2011 Sep 8. 10.1016/j.immuni.2011.06.014 PubMed 21903422