Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pcDNA-gp78-FLAG
(Plasmid #62370)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 62370 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pCDNA3
  • Backbone size w/o insert (bp) 5400
  • Total vector size (bp) 7332
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Top10
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    gp78
  • Alt name
    AMFR, RNF45
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1932
  • Mutation
    *
  • GenBank ID
    NM_001144.5
  • Entrez Gene
    AMFR (a.k.a. GP78, RNF45)
  • Tag / Fusion Protein
    • FLAG (C terminal on insert)

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer ATTTAGGTGACACTATAG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Emmanuel Wiertz Lab

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

*P179L mutation found during Addgene's quality control sequencing is not known to affect function

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pcDNA-gp78-FLAG was a gift from Yihong Ye (Addgene plasmid # 62370 ; http://n2t.net/addgene:62370 ; RRID:Addgene_62370)
  • For your References section:

    USP13 antagonizes gp78 to maintain functionality of a chaperone in ER-associated degradation. Liu Y, Soetandyo N, Lee JG, Liu L, Xu Y, Clemons WM Jr, Ye Y. Elife. 2014;3:e01369. doi: 10.7554/eLife.01369. Epub 2014 Jan 14. 10.7554/eLife.01369 PubMed 24424410