pEGFP-CHAMP1
(Plasmid #159892)

• Purpose: Expresses CHAMP1 (CAMP) in mammalian cells
• Depositing Lab: Kozo Tanaka
• Depositing Organization: Tohoku University
  Located in Japan
• Publication: Itoh et al EMBO J. 2011 Jan 5;30(1):130-44. doi: 10.1038/emboj.2010.276. Epub 2010 Nov 9.

Backbone

• Vector backbone: pEGFP-C1
• Backbone manufacturer: Clontech (TaKaRa)
• Backbone size w/o insert (bp): 4731
• Total vector size (bp): 7164
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: CHAMP1
• Alt name: CAMP (chromosome alignment-maintaining phosphoprotein), C13orf8, ZNF828
• Species: H. sapiens (human)
• Insert Size (bp): 2436
• GenBank ID: NM_032436 NM_001164144
• Entrez Gene: CHAMP1 (a.k.a. C13orf8, CAMP, CHAMP, MRD40, ZNF828)
• Promoter: CMV
• Tag / Fusion Protein:
  • pEGFP (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (not destroyed)
• 3′ cloning site: SalI (not destroyed)
• 5′ sequencing primer: CATGGTCCTGCTGGAGTTCGTG
• 3′ sequencing primer: CATTTTATGTTTCAGGTTCAGG

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Addgene QC identified a partial deletion of the SV40 promoter compared to the hypothetical plasmid sequence. The depositing lab does not consider this to be of concern in regard to the function of this plasmid

DNA (Catalog # 159892-D50)

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

• Amount: 50 μg
• Concentration: 1 μg/μL
• Pricing: $495 USD
• Storage: 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

DNA (Catalog # 159892-D100)

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

• Amount: 100 μg
• Concentration: 1 μg/μL
• Pricing: $585 USD
• Storage: 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.