pEGFP-CHAMP1
(Plasmid #159892)

• Purpose: Expresses CHAMP1 (CAMP) in mammalian cells
• Depositing Lab: Kozo Tanaka
• Publication: Itoh et al EMBO J. 2011 Jan 5;30(1):130-44. doi: 10.1038/emboj.2010.276. Epub 2010 Nov 9.

Backbone

• Vector backbone: pEGFP-C1
• Backbone manufacturer: Clontech (TaKaRa)
• Backbone size w/o insert (bp): 4731
• Total vector size (bp): 7164
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: CHAMP1
• Alt name: CAMP (chromosome alignment-maintaining phosphoprotein), C13orf8, ZNF828
• Species: H. sapiens (human)
• Insert Size (bp): 2436
• GenBank ID: NM_032436 NM_001164144
• Entrez Gene: CHAMP1 (a.k.a. C13orf8, CAMP, CHAMP, MRD40, ZNF828)
• Promoter: CMV
• Tag / Fusion Protein:
  • pEGFP (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (not destroyed)
• 3′ cloning site: SalI (not destroyed)
• 5′ sequencing primer: CATGGTCCTGCTGGAGTTCGTG
• 3′ sequencing primer: CATTTTATGTTTCAGGTTCAGG

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Addgene QC identified a partial deletion of the SV40 promoter compared to the hypothetical plasmid sequence. The depositing lab does not consider this to be of concern in regard to the function of this plasmid