pAAV-Ef1a-DIO-Sun1GFP-WPRE-pA
(Plasmid #160141)

• Purpose: Cre- dependent expression of Sun1GFP for nuclei isolation
• Depositing Lab: Andreas Pfenning
• Publication: Lawler et al J Neurosci. 2020 Nov 10. pii: JNEUROSCI.1634-20.2020. doi: 10.1523/JNEUROSCI.1634-20.2020.

Backbone

• Vector backbone: pAAV-Ef1a-DIO-EGFP-WPRE-pA
• Backbone manufacturer: Bernardo Sabatini Lab
• Backbone size w/o insert (bp): 5662
• Total vector size (bp): 6342
• Vector type: Mammalian Expression, AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: Sun1-GFP
• Alt name: Sun1-sfGFP
• Species: M. musculus (mouse)
• Insert Size (bp): 2370
• Mutation: N-truncated: removed amino acids 1-207, retained 208-757
• GenBank ID: NM_001256118.1
• Entrez Gene: Sun1 (a.k.a. 4632417G13Rik, 5730434D03Rik, Unc84a, mKIAA0810)
• Promoter: Ef1a
• Tag / Fusion Protein:
  • GFP (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: SgsI (not destroyed)
• 3′ cloning site: BspoI (not destroyed)
• 5′ sequencing primer: CCAGCTTGGCACTTGATGTA
• 3′ sequencing primer: AGTCATGCCGTTTCATGTGA

Resource Information

• Supplemental Documents:
  • pAAV-Ef1a-DIO-Sun1GFP-WPRE-pA.gb
• A portion of this plasmid was derived from a plasmid made by: Bernardo Sabatini Lab, Harvard University.
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry