pAG25-1199 cDNA
(Plasmid #160379)

• Purpose: N1199 narnavirus cDNA
• Depositing Lab: John McCusker
• Publication: Yeast viruses (unpublished)

Backbone

• Vector backbone: pAG25
• Backbone size w/o insert (bp): 3704
• Total vector size (bp): 6500
• Vector type: Yeast Expression
• Selectable markers: Nourseothricin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: N1199
• Species: S. cerevisiae (budding yeast)
• Insert Size (bp): 2800
• Promoter: NA

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRV (destroyed during cloning)
• 3′ cloning site: EcoRV (destroyed during cloning)
• 5′ sequencing primer: TAATACGACTCACTATAGGG
• 3′ sequencing primer: CGTATGTGAATGCTGGTC

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

2.8 kb dsRNA species gel purified from yJM 1199 and ligated to PC3 oligo (/5Phos/GG ATC CCG GGA ATT CGG TAA TAC GAC TCA CTA TAT TTT TAT AGT GAG TCG TAT TA). After reverse transcription and strand annealing, cDNA amplified with PC2 primer (CCG AAT TCC CGG GAT CC )to yield a 2.8 kb fragment. Fragment phosphorylated and ligated to pAG25 digested with EcoRV and phosphatase treated. Clones checked with restriction digest and sequencing. Near full length N1199 cDNA