Skip to main content

pCY_gRNA_hPAX7-Pro_C6
(Plasmid #160457)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 160457 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 160457-D50 50 μg of DNA in Tris buffer $495
DNA 160457-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    gRNA_Cloning Vector
  • Backbone manufacturer
    41824
  • Backbone size w/o insert (bp) 3910
  • Total vector size (bp) 3973
  • Modifications to backbone
    The AflII site was destroyed during cloning which results in a loss of 4 bp from the original backbone (3914 bp)
  • Vector type
    Mammalian Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    gRNA_hPAX7-Promoter_C6
  • gRNA/shRNA sequence
    GCCCCGGCTCGACCTCGTTT
  • Species
    H. sapiens (human)
  • GenBank ID
    NM_001135254
  • Promoter U6

Cloning Information

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCY_gRNA_hPAX7-Pro_C6 was a gift from April Pyle (Addgene plasmid # 160457 ; http://n2t.net/addgene:160457 ; RRID:Addgene_160457)
  • For your References section:

    Generation of PAX7 Reporter Cells to Investigate Skeletal Myogenesis from Human Pluripotent Stem Cells. Xi H, Young CS, Pyle AD. STAR Protoc. 2020 Nov 5;1(3):100158. doi: 10.1016/j.xpro.2020.100158. eCollection 2020 Dec 18. 10.1016/j.xpro.2020.100158 PubMed 33377052