Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pCY_gRNA_hPAX7-Pro_C5
(Plasmid #160456)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 160456 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    gRNA_Cloning Vector
  • Backbone manufacturer
    41824
  • Backbone size w/o insert (bp) 3910
  • Total vector size (bp) 3973
  • Modifications to backbone
    The AflII site was destroyed during cloning which results in a loss of 4 bp from the original backbone (3914 bp)
  • Vector type
    Mammalian Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    gRNA_hPAX7-Promoter_C5
  • gRNA/shRNA sequence
    GGGTCCGGAGAAAGAAGGCG
  • Species
    H. sapiens (human)
  • GenBank ID
    NM_001135254
  • Promoter U6

Cloning Information

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCY_gRNA_hPAX7-Pro_C5 was a gift from April Pyle (Addgene plasmid # 160456 ; http://n2t.net/addgene:160456 ; RRID:Addgene_160456)
  • For your References section:

    Generation of PAX7 Reporter Cells to Investigate Skeletal Myogenesis from Human Pluripotent Stem Cells. Xi H, Young CS, Pyle AD. STAR Protoc. 2020 Nov 5;1(3):100158. doi: 10.1016/j.xpro.2020.100158. eCollection 2020 Dec 18. 10.1016/j.xpro.2020.100158 PubMed 33377052