pHX_HDR_hPAX7_IRES-EGFP-PGK-Neo
(Plasmid #160458)

• Purpose: Homology-directed recombination donor vector for EGFP reporter knock-in to human PAX7 3' UTR
• Depositing Lab: April Pyle
• Depositing Organization: University of California, Los Angeles (UCLA)
  Located in United States of America
• Publication: Xi et al STAR Protoc. 2020 Nov 5;1(3):100158. doi: 10.1016/j.xpro.2020.100158. eCollection 2020 Dec 18.

Backbone

• Vector backbone: Oct4-IRES-eGFP-PGK-Neo
• Backbone manufacturer: 48681
• Backbone size w/o insert (bp): 5978
• Total vector size (bp): 7328
• Modifications to backbone: The homology arms of mouse Oct4 in the backbone vector are replaced by human PAX7 homology arms
• Vector type: Insertion of a fluorescent reporter through homology-directed recombination
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: PAX7 Left/5' Homology Arm
• Species: H. sapiens (human)
• Insert Size (bp): 650
• GenBank ID: NM_001135254
• Entrez Gene: PAX7 (a.k.a. CMYO19, CMYP19, HUP1, MYOSCO, PAX7B, RMS2)

Cloning Information for Gene/Insert 1

• Cloning method: Gibson Cloning
• 5′ sequencing primer: M13R: CAGGAAACAGCTATGAC
• 3′ sequencing primer: AAAGGAATGCAAGGTCTGTT

Gene/Insert 2

• Gene/Insert name: PAX7 Right/3' Homology Arm
• Species: H. sapiens (human)
• Insert Size (bp): 700
• GenBank ID: NM_001135254
• Entrez Gene: PAX7 (a.k.a. CMYO19, CMYP19, HUP1, MYOSCO, PAX7B, RMS2)

Cloning Information for Gene/Insert 2

• Cloning method: Gibson Cloning
• 5′ sequencing primer: NeoF: CGTTGGCTACCCGTGATATT
• 3′ sequencing primer: M13(-47): GTTTTCCCAGTCACGAC

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

DNA (Catalog # 160458-D50)

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

• Amount: 50 μg
• Concentration: 1 μg/μL
• Pricing: $495 USD
• Storage: 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

DNA (Catalog # 160458-D100)

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

• Amount: 100 μg
• Concentration: 1 μg/μL
• Pricing: $585 USD
• Storage: 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.