pCS2+-HypocratesCS
(Plasmid
#161960)
-
PurposeMammalian expression of non-targeted inactivated control version of genetically encoded biosensor for (pseudo)hypohalous acids and their derivatives
-
Depositing Lab
-
Depositing OrganizationShemyakin-Ovchinnikov Institute of Bioorganic Chemistry (INACTIVE)
Located in Russian Federation -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 161960 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 161960-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 161960-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepCS2+
- Backbone size w/o insert (bp) 4078
- Total vector size (bp) 5425
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameHypocrates
-
Alt nameNemR-cpYFP
-
SpeciesSynthetic
-
Insert Size (bp)1347
-
Mutationchanged Cysteine 355 to Serine
- Promoter CMV, SP6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site ClaI (not destroyed)
- 3′ cloning site XbaI (not destroyed)
- 5′ sequencing primer TCGGAGCAAGCTTGATTTAGGTGACACTATA
- 3′ sequencing primer GCATTCTAGTTGTGGTTTGTCCAAACTCATC
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2021.02.22.432222 for bioRxiv preprint.
DNA (Catalog # 161960-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 161960-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCS2+-HypocratesCS was a gift from Dmitry Bilan (Addgene plasmid # 161960 ; http://n2t.net/addgene:161960 ; RRID:Addgene_161960) -
For your References section:
Hypocrates is a genetically encoded fluorescent biosensor for (pseudo)hypohalous acids and their derivatives. Kostyuk AI, Tossounian MA, Panova AS, Thauvin M, Raevskii RI, Ezerina D, Wahni K, Van Molle I, Sergeeva AD, Vertommen D, Gorokhovatsky AY, Baranov MS, Vriz S, Messens J, Bilan DS, Belousov VV. Nat Commun. 2022 Jan 10;13(1):171. doi: 10.1038/s41467-021-27796-2. 10.1038/s41467-021-27796-2 PubMed 35013284
Map uploaded by the depositor.
