pET28a-B4E
(Plasmid #162067)

• Purpose: For expresion of the B4E fusion protein, consists of the ampR gene (encoding the enzyme β-lactamase without the native signal sequence) fused to residues 28-215 of the murine eIF4E
• Depositing Lab: Karen Polizzi
• Publication: Moya-Ramirez et al Nucleic Acids Res. 2020 Dec 16;48(22):e129. doi: 10.1093/nar/gkaa955.

Backbone

• Vector backbone: pET28a
• Backbone size w/o insert (bp): 5207
• Total vector size (bp): 6734
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Growth instructions: Grow in BL21 for protein expression at 25ºC after induction with IPTG
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: ampR-eIF4E fusion protein
• Alt name: B4E
• Species: Synthetic; E.coli
• Insert Size (bp): 1527
• Mutation: eIF4E incorporating the K119A mutation, which is known to increase the cap binding affinity of the protein
• Promoter: T7
• Tag / Fusion Protein:
  • 6xHis tag (N terminal on insert)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: ggtgatgtcggcgatatagg
• 3′ sequencing primer: gctagttattgctcagcgg

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry