pET28a-λN-βLac
(Plasmid #162039)

• Purpose: Expresion of the fusion protein of the λN domain of the λ phage and ampR gene (encoding the enzyme β-lactamase without the native signal sequence)
• Depositing Lab: Karen Polizzi
• Publication: Moya Ramirez et al Biosens Bioelectron. 2019 Jul 15;137:199-206. doi: 10.1016/j.bios.2019.05.008. Epub 2019 May 7.

Backbone

• Vector backbone: pET28a
• Backbone size w/o insert (bp): 5207
• Total vector size (bp): 6146
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Growth instructions: Grow in BL21 for protein expression at 25ºC after induction with IPTG
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: λN domain of the λ phage and a β-lactamase fusion protein
• Alt name: λN-βLac
• Species: Synthetic
• Insert Size (bp): 939
• Promoter: T7
• Tag / Fusion Protein:
  • 6xHis tag (C terminal on insert)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: ggtgatgtcggcgatatagg
• 3′ sequencing primer: gctagttattgctcagcgg

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry