-
PurposeDoxycycline-inducible overexpression of eGFP
-
Depositing Lab
-
Depositing OrganizationBrigham and Women's Hospital
Located in United States of America -
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 162823 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backboneAddgene plasmid pCW-Cas9 (plasmid#50661)
- Backbone size w/o insert (bp) 7600
- Total vector size (bp) 8329
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameeGFP
-
Insert Size (bp)720
-
MutationV163A
- Promoter Tet ON
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer pCW Seq F: AGCTCGTTTAGTGAACCGTCAGATC
- 3′ sequencing primer pCW Seq R: GAACGGACGTGAAGAATGTG
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byeGFP was amplified from commercial cDNAs and switched with Cas9 from Addgene plasmid pCW-Cas9 (plasmid #50661).
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCW-eGFP was a gift from Matthew Steinhauser (Addgene plasmid # 162823 ; http://n2t.net/addgene:162823 ; RRID:Addgene_162823) -
For your References section:
Prolonged fasting drives a program of metabolic inflammation in human adipose tissue. Fazeli PK, Zhang Y, O'Keefe J, Pesaresi T, Lun M, Lawney B, Steinhauser ML. Mol Metab. 2020 Sep 28;42:101082. doi: 10.1016/j.molmet.2020.101082. 10.1016/j.molmet.2020.101082 PubMed 32992039