pCW-SPI1
(Plasmid #162824)

• Purpose: Doxycycline-inducible overexpression of human SPI1
• Depositing Lab: Matthew Steinhauser
• Publication: Fazeli et al Mol Metab. 2020 Sep 28;42:101082. doi: 10.1016/j.molmet.2020.101082.

Backbone

• Vector backbone: Addgene plasmid pCW-Cas9 (plasmid#50661)
• Backbone size w/o insert (bp): 7600
• Total vector size (bp): 8418
• Vector type: Mammalian Expression, Lentiviral
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: SPI1
• Alt name: Transcription factor PU.1
• Species: H. sapiens (human)
• Insert Size (bp): 816
• Entrez Gene: SPI1 (a.k.a. AGM10, OF, PU.1, SFPI1, SPI-1, SPI-A)
• Promoter: Tet ON

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: pCW Seq F: AGCTCGTTTAGTGAACCGTCAGATC
• 3′ sequencing primer: pCW Seq R: GAACGGACGTGAAGAATGTG

Resource Information

• A portion of this plasmid was derived from a plasmid made by: SPI1 was amplified from commercial cDNAs and switched with Cas9 from Addgene plasmid pCW-Cas9 (plasmid #50661).

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry