pTBL1401 pLenti-pEF1a(short)-mNeonGreen-P2A-Cas9
(Plasmid #163644)

• Purpose: Makes a lentivirus that expresses mNeonGreen and Cas9.
• Depositing Lab: Chang Liu
• Publication: Loveless et al Nat Chem Biol. 2021 Jun;17(6):739-747. doi: 10.1038/s41589-021-00769-8. Epub 2021 Mar 22.

Backbone

• Vector backbone: lenti, 3rd generation
• Backbone manufacturer: Phil Sharp and Feng Zhang, Addgene Plasmid #63592
• Backbone size w/o insert (bp): 8251
• Total vector size (bp): 13264
• Modifications to backbone: Switched the order of the fluorescent protein and Cas9, and replaced EGFP with mNeonGreen. Also removed an EcoRI site 3' of Cas9.
• Vector type: Lentiviral
• Selectable markers: mNeonGreen

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): NEB Stable
• Growth instructions: Cells can be grown at 37C, but growth at 30C is recommended for NEBStable.
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: mNeonGreen-P2A-Cas9
• Species: Synthetic
• Promoter: EFS
• Tag / Fusion Protein:
  • mNeonGreen-P2A (N terminal on insert)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: GAAAGTGATGTCGTGTACTGG
• 3′ sequencing primer: GAGGTTGATTACCGATAAGC

Resource Information

• A portion of this plasmid was derived from a plasmid made by: mNeonGreen was cloned from pmNeonGreenHO-G, Addgene Plasmid #127912, made by the lab of Isei Tanida.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • mNeonGreen Label License
• Industry Terms:
  • Not Available to Industry

Depositor Comments

This is a 3rd generation lentiviral transfer plasmid. Please visit https://doi.org/10.1101/639120 for bioRxiv preprint.