pRM15
(Plasmid
#163694)
-
Purposehsp70 promoter inducible expression of DHB:mScarlet-P2A-H2B:miRFP670
-
Depositing Lab
-
Depositing OrganizationStony Brook University
Located in the United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 163694 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 163694-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 163694-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backboneTol2
- Backbone size w/o insert (bp) 8124
- Total vector size (bp) 10266
-
Vector typeZebrafish expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameDHB:mScarlet-P2A-H2B:miRFP670
-
Alt nameDNA Helicase B (CDK sensor) (aa 994–1087) (HELB)
-
Alt nameH2BC11
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2412
-
GenBank IDNM_021058.4 NM_001370285.1
-
Entrez GeneHELB (a.k.a. DHB, hDHB)
-
Entrez GeneH2BC11 (a.k.a. H2B/r, H2BFR, H2BJ, HIST1H2BJ)
- Promoter HSP70
-
Tags
/ Fusion Proteins
- mScarlet (C terminal on insert)
- miRFP670 (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GTAATACGACTCACTATAGGG
- 3′ sequencing primer CTATAGTGTCACCTAAAT
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
DNA Helicase B (DHB) as a CDK sensor described in:
Hahn, A.T., Jones, J.T., and Meyer, T. (2009). Quantitative analysis of cell cycle phase durations and PC12 differentiation using fluorescent biosensors. Cell Cycle 8, 1044-1052.
Spencer, S.L., Cappell, S.D., Tsai, F.C., Overton, K.W., Wang, C.L., and Meyer, T. (2013). The proliferation-quiescence decision is controlled by a bifurcation in CDK2 activity at mitotic exit. Cell 155, 369-383.
DNA (Catalog # 163694-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 163694-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pRM15 was a gift from David Matus (Addgene plasmid # 163694 ; http://n2t.net/addgene:163694 ; RRID:Addgene_163694) -
For your References section:
Visualizing the metazoan proliferation-quiescence decision in vivo. Adikes RC, Kohrman AQ, Martinez MAQ, Palmisano NJ, Smith JJ, Medwig-Kinney TN, Min M, Sallee MD, Ahmed OB, Kim N, Liu S, Morabito RD, Weeks N, Zhao Q, Zhang W, Feldman JL, Barkoulas M, Pani AM, Spencer SL, Martin BL, Matus DQ. Elife. 2020 Dec 22;9. pii: 63265. doi: 10.7554/eLife.63265. 10.7554/eLife.63265 PubMed 33350383