pRM14
(Plasmid #163693)

• Purpose: hsp70 promoter inducible expression of DHB:mNeonGreen-P2A-H2B:mScarlet
• Depositing Lab: David Matus
• Depositing Organization: Stony Brook University
  Located in United States of America
• Publication: Adikes et al Elife. 2020 Dec 22;9. pii: 63265. doi: 10.7554/eLife.63265.

Backbone

• Vector backbone: Tol2
• Backbone size w/o insert (bp): 7854
• Total vector size (bp): 10029
• Modifications to backbone: mammalian DNA helicase B (DHB) amino acids 994-1087 fused to mNeonGreen co-expressed with H2B::mScarlet cloned between BamHI and ClaI sites
• Vector type: Unspecified ; Zebrafish expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: DHB:mNeonGreen-P2A-H2B:mScarlet
• Alt name: DNA Helicase B (CDK sensor) (aa 994–1087) (HELB)
• Alt name: H2BC11
• Species: H. sapiens (human)
• GenBank ID: NM_021058.4 NM_001370285.1
• Entrez Gene: HELB (a.k.a. DHB, hDHB)
• Entrez Gene: H2BC11 (a.k.a. H2B/r, H2BFR, H2BJ, HIST1H2BJ)
• Promoter: HSP70
• Tags / Fusion Proteins:
  • mNeonGreen (C terminal on insert)
  • mScarlet (C terminal on insert)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: ATTTAGGTGACACTATAG
• 3′ sequencing primer: ATTAACCCTCACTAAAGGGA

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • mNeonGreen Label License
  • National Institute of Genetics Limited Use Label License for Tol2 System
• Industry Terms:
  • Not Available to Industry

Depositor Comments

DNA Helicase B (DHB) as a CDK sensor described in:
Hahn, A.T., Jones, J.T., and Meyer, T. (2009). Quantitative analysis of cell cycle phase durations and PC12 differentiation using fluorescent biosensors. Cell Cycle 8, 1044-1052.

Spencer, S.L., Cappell, S.D., Tsai, F.C., Overton, K.W., Wang, C.L., and Meyer, T. (2013). The proliferation-quiescence decision is controlled by a bifurcation in CDK2 activity at mitotic exit. Cell 155, 369-383.

DNA (Catalog # 163693-D50)

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

• Amount: 50 μg
• Concentration: 1 μg/μL
• Pricing: $495 USD
• Storage: 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • mNeonGreen Label License
  • National Institute of Genetics Limited Use Label License for Tol2 System
• Industry Terms:
  • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

DNA (Catalog # 163693-D100)

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

• Amount: 100 μg
• Concentration: 1 μg/μL
• Pricing: $585 USD
• Storage: 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • mNeonGreen Label License
  • National Institute of Genetics Limited Use Label License for Tol2 System
• Industry Terms:
  • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.