pRM15
(Plasmid #163694)

• Purpose: hsp70 promoter inducible expression of DHB:mScarlet-P2A-H2B:miRFP670
• Depositing Lab: David Matus
• Publication: Adikes et al Elife. 2020 Dec 22;9. pii: 63265. doi: 10.7554/eLife.63265.

Backbone

• Vector backbone: Tol2
• Backbone size w/o insert (bp): 8124
• Total vector size (bp): 10266
• Vector type: Zebrafish expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: DHB:mScarlet-P2A-H2B:miRFP670
• Alt name: DNA Helicase B (CDK sensor) (aa 994–1087) (HELB)
• Alt name: H2BC11
• Species: H. sapiens (human)
• Insert Size (bp): 2412
• GenBank ID: NM_021058.4 NM_001370285.1
• Entrez Gene: HELB (a.k.a. DHB, hDHB)
• Entrez Gene: H2BC11 (a.k.a. H2B/r, H2BFR, H2BJ, HIST1H2BJ)
• Promoter: HSP70
• Tags / Fusion Proteins:
  • mScarlet (C terminal on insert)
  • miRFP670 (C terminal on insert)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: GTAATACGACTCACTATAGGG
• 3′ sequencing primer: CTATAGTGTCACCTAAAT

Resource Information

• Supplemental Documents:
  • pRM15_HSP70-R_R DHB_NGS.ape

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • National Institute of Genetics Limited Use Label License for Tol2 System
• Industry Terms:
  • Not Available to Industry

Depositor Comments

DNA Helicase B (DHB) as a CDK sensor described in:
Hahn, A.T., Jones, J.T., and Meyer, T. (2009). Quantitative analysis of cell cycle phase durations and PC12 differentiation using fluorescent biosensors. Cell Cycle 8, 1044-1052.

Spencer, S.L., Cappell, S.D., Tsai, F.C., Overton, K.W., Wang, C.L., and Meyer, T. (2013). The proliferation-quiescence decision is controlled by a bifurcation in CDK2 activity at mitotic exit. Cell 155, 369-383.