pYX233-b2-DHFR
(Plasmid
#163759)
-
PurposeGal-inducible yeast expression of the mitochondrial "clogger" protein b2(167)-DHFR
-
Depositing Lab
-
Depositing OrganizationRheinland-Pfälzische Technische Universität Kaiserslautern
Located in Germany -
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 163759 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepYX233
- Backbone size w/o insert (bp) 7400
- Total vector size (bp) 8500
-
Vector typeYeast Expression
-
Selectable markersTRP1
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsYeast strains should be grown without galactose for the transformation as well as in precultures for experiments. Expression of b2-DHFR after induction with galactose is proteotoxic and will result in growth arrest.
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameb2-DHFR
-
Alt nameb2(167)-DHFR
-
SpeciesM. musculus (mouse), S. cerevisiae (budding yeast)
-
Insert Size (bp)1071
-
MutationAmino acids 1-167 of S.c. Cytochrome b2 (Cyb2) fused to mouse DHFR
-
Entrez GeneDhfr (a.k.a. 8430436I03Rik)
- Promoter GAL1
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer ATATACCTCTATACTTTAAC
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pYX233-b2-DHFR was a gift from Johannes Herrmann (Addgene plasmid # 163759 ; http://n2t.net/addgene:163759 ; RRID:Addgene_163759) -
For your References section:
Mitochondrial protein-induced stress triggers a global adaptive transcriptional programme. Boos F, Kramer L, Groh C, Jung F, Haberkant P, Stein F, Wollweber F, Gackstatter A, Zoller E, van der Laan M, Savitski MM, Benes V, Herrmann JM. Nat Cell Biol. 2019 Apr;21(4):442-451. doi: 10.1038/s41556-019-0294-5. Epub 2019 Mar 18. 10.1038/s41556-019-0294-5 PubMed 30886345