pYX233-b2delta-DHFR
(Plasmid #163760)

• Purpose: Gal-inducible yeast expression of the mitochondrial "clogger" protein b2(167)delta(19)-DHFR
• Depositing Lab: Johannes Herrmann
• Publication: Boos et al Nat Cell Biol. 2019 Apr;21(4):442-451. doi: 10.1038/s41556-019-0294-5. Epub 2019 Mar 18.

Backbone

• Vector backbone: pYX233
• Backbone size w/o insert (bp): 7400
• Total vector size (bp): 8500
• Vector type: Yeast Expression
• Selectable markers: TRP1

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Growth instructions: Yeast strains should be grown without galactose for the transformation as well as in precultures for experiments. Expression of b2delta-DHFR after induction with galactose is proteotoxic and will result in growth arrest.
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: b2delta-DHFR
• Alt name: b2(167)delta(19)-DHFR
• Species: M. musculus (mouse), S. cerevisiae (budding yeast)
• Insert Size (bp): 1014
• Mutation: Amino acids 1-167 of S.c. Cytochrome b2 (Cyb2) fused to mouse DHFR. The stop-transfer signal (transmembrane domain) of cytochrome b2 were deleted (19 amino acids) so that the protein is targeted to the mitochondrial matrix.
• Entrez Gene: Dhfr (a.k.a. 8430436I03Rik)
• Promoter: GAL1

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (not destroyed)
• 3′ cloning site: HindIII (not destroyed)
• 5′ sequencing primer: ATATACCTCTATACTTTAAC

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry