Skip to main content

pYX233-DHFR
(Plasmid #163761)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 163761 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    pYX233
  • Backbone size w/o insert (bp) 7400
  • Total vector size (bp) 8100
  • Vector type
    Yeast Expression
  • Selectable markers
    TRP1

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    Yeast strains should be grown without galactose for the transformation as well as in precultures for experiments. Expression of cytosolic DHFR after induction with galactose is not proteotoxic and does not affect cell growth.
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    DHFR
  • Alt name
    cyt DHFR
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    564
  • Entrez Gene
    Dhfr (a.k.a. 8430436I03Rik)
  • Promoter GAL1

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer ATATACCTCTATACTTTAAC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pYX233-DHFR was a gift from Johannes Herrmann (Addgene plasmid # 163761 ; http://n2t.net/addgene:163761 ; RRID:Addgene_163761)
  • For your References section:

    Mitochondrial protein-induced stress triggers a global adaptive transcriptional programme. Boos F, Kramer L, Groh C, Jung F, Haberkant P, Stein F, Wollweber F, Gackstatter A, Zoller E, van der Laan M, Savitski MM, Benes V, Herrmann JM. Nat Cell Biol. 2019 Apr;21(4):442-451. doi: 10.1038/s41556-019-0294-5. Epub 2019 Mar 18. 10.1038/s41556-019-0294-5 PubMed 30886345