pYX233-DHFR
(Plasmid
#163761)
-
PurposeGal-inducible yeast expression of cytosolic DHFR
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 163761 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepYX233
- Backbone size w/o insert (bp) 7400
- Total vector size (bp) 8100
-
Vector typeYeast Expression
-
Selectable markersTRP1
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsYeast strains should be grown without galactose for the transformation as well as in precultures for experiments. Expression of cytosolic DHFR after induction with galactose is not proteotoxic and does not affect cell growth.
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameDHFR
-
Alt namecyt DHFR
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)564
-
Entrez GeneDhfr (a.k.a. 8430436I03Rik)
- Promoter GAL1
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer ATATACCTCTATACTTTAAC
- (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pYX233-DHFR was a gift from Johannes Herrmann (Addgene plasmid # 163761 ; http://n2t.net/addgene:163761 ; RRID:Addgene_163761) -
For your References section:
Mitochondrial protein-induced stress triggers a global adaptive transcriptional programme. Boos F, Kramer L, Groh C, Jung F, Haberkant P, Stein F, Wollweber F, Gackstatter A, Zoller E, van der Laan M, Savitski MM, Benes V, Herrmann JM. Nat Cell Biol. 2019 Apr;21(4):442-451. doi: 10.1038/s41556-019-0294-5. Epub 2019 Mar 18. 10.1038/s41556-019-0294-5 PubMed 30886345