Skip to main content
Addgene
Open Menu

AAVS1_puro_CAG_HexaPro
(Plasmid #164077)

Print

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 164077 Standard format: Plasmid sent in bacteria as agar stab 1 $94 *
Add to Cart
DNA 164077-D50 50 μg of DNA in Tris buffer $495 *
Add to Cart
DNA 164077-D100 100 μg of DNA in Tris buffer $585 *
Add to Cart

* Log in to view industry pricing.

Backbone

  • Vector backbone
    AAVS1_Puro_PGK1_3xFLAG_Twin_Strep (Addgene plasmid # 68375)
  • Vector type
    Mammalian Expression, CRISPR
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    SARS-CoV-2 S HexaPro
  • Species
    Severe acute respiratory syndrome coronavirus 2
  • Insert Size (bp)
    3624
  • Mutation
    Ectodomain only (AAs 1-1208); 682-685 (furin site) replaced with 'GSAS'; F817P, A892P, A899P, A942P, K986P, V987P
  • GenBank ID
    MN908947
  • Entrez Gene
    S (a.k.a. GU280_gp02, spike glycoprotein)
  • Promoter CAG
  • Tags / Fusion Proteins
    • HRV 3C cleavage site (before tags) (C terminal on insert)
    • 8X His tag (C terminal on insert)
    • 2X Strep-Tag II (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SpeI (not destroyed)
  • 3′ cloning site BstBI (not destroyed)
  • 5′ sequencing primer TCGGCTTCTGGCGTGTGACC
  • 3′ sequencing primer GAGGGGCAAACAACAGATGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The promoter and insert elements were derived from SARS-CoV-2 S HexaPro, a gift from Jason McLellan (Addgene plasmid # 154754).

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    AAVS1_puro_CAG_HexaPro was a gift from Yannick Doyon (Addgene plasmid # 164077 ; http://n2t.net/addgene:164077 ; RRID:Addgene_164077)

  • For your References section:

    Artisanal production of prefusion-stabilized SARS-CoV-2 spikes. Rivest JF, Goupil C, Doyon Y. protocols.io 2021 10.17504/protocols.io.buyfnxtn
Related items:
Commonly requested with: