mCherry_eDHFR_SIM#1
(Plasmid
#164646)
-
Purposetag SIM with mCherry and eDHFR
-
Depositing Labs
-
Depositing OrganizationUniversity of Pennsylvania
Located in United States of America -
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 164646 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backboneRMCE
- Backbone size w/o insert (bp) 7208
- Total vector size (bp) 7284
-
Vector typeMammalian Expression, Cre/Lox
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameSIM
-
Alt namesumo interacting motif
-
SpeciesH. sapiens (human)
-
Insert Size (bp)74
- Promoter CAG
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AflII (not destroyed)
- 3′ cloning site NotI (destroyed during cloning)
- 5′ sequencing primer gtcaacatcaagttggacatcac
- 3′ sequencing primer ATTAGCCAGAAGTCAGATGCTC
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
SIM from Michael Rosen Lab
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
mCherry_eDHFR_SIM#1 was a gift from Michael Lampson & Huaiying Zhang (Addgene plasmid # 164646 ; http://n2t.net/addgene:164646 ; RRID:Addgene_164646) -
For your References section:
Nuclear body phase separation drives telomere clustering in ALT cancer cells. Zhang H, Zhao R, Tones J, Liu M, Dilley RL, Chenoweth DM, Greenberg RA, Lampson MA. Mol Biol Cell. 2020 Aug 15;31(18):2048-2056. doi: 10.1091/mbc.E19-10-0589. Epub 2020 Jun 24. 10.1091/mbc.E19-10-0589 PubMed 32579423