RGG-mCherry-RGG-eDHFR
(Plasmid #164648)

• Purpose: Two RGG domains tagged with mCherry and eDHFR
• Depositing Labs: Michael Lampson, Huaiying Zhang
• Publication: Zhang et al Mol Biol Cell. 2020 Aug 15;31(18):2048-2056. doi: 10.1091/mbc.E19-10-0589. Epub 2020 Jun 24.

Backbone

• Vector backbone: RMCE
• Backbone size w/o insert (bp): 7252
• Total vector size (bp): 8254
• Vector type: Mammalian Expression, Cre/Lox
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: RGG
• Alt name: arginine/glycine rich domain from the P granule component LAF-1
• Species: H. sapiens (human)
• Insert Size (bp): 501
• Promoter: CAG

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: AscI (not destroyed)
• 3′ cloning site: FseI (destroyed during cloning)
• 5′ sequencing primer: cttctggcgtgtgaccggcggctc
• 3′ sequencing primer: CCCTCGATCTCGAACTCGTGG

Resource Information

• Supplemental Documents:
  • pHZ088_RGG-mCherry-RGG-eDHFR.ape

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry

Depositor Comments

RGG is from Benjamin Schuster lab