Skip to main content

mCherry-eDHFR-SIMvada
(Plasmid #164649)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 164649 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    RMCE
  • Vector type
    Mammalian Expression, Cre/Lox

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    SIMvada
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    69
  • Promoter CAG

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AflII (destroyed during cloning)
  • 3′ cloning site NotI (destroyed during cloning)
  • 5′ sequencing primer ATTAGCCAGAAGTCAGATGCTC
  • 3′ sequencing primer none
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    SIM mutant from Michael Rosen Lab

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    mCherry-eDHFR-SIMvada was a gift from Michael Lampson & Huaiying Zhang (Addgene plasmid # 164649 ; http://n2t.net/addgene:164649 ; RRID:Addgene_164649)
  • For your References section:

    Nuclear body phase separation drives telomere clustering in ALT cancer cells. Zhang H, Zhao R, Tones J, Liu M, Dilley RL, Chenoweth DM, Greenberg RA, Lampson MA. Mol Biol Cell. 2020 Aug 15;31(18):2048-2056. doi: 10.1091/mbc.E19-10-0589. Epub 2020 Jun 24. 10.1091/mbc.E19-10-0589 PubMed 32579423