3XHalo_GFP_TRF1#1
(Plasmid #164644)

• Purpose: tag TRF1 with GFP and Halo
• Depositing Labs: Michael Lampson, Huaiying Zhang
• Publication: Zhang et al Mol Biol Cell. 2020 Aug 15;31(18):2048-2056. doi: 10.1091/mbc.E19-10-0589. Epub 2020 Jun 24.

Backbone

• Vector backbone: RMCE
• Backbone size w/o insert (bp): 9438
• Total vector size (bp): 10677
• Vector type: Mammalian Expression, Cre/Lox
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: TRF1
• Alt name: TERF1
• Species: H. sapiens (human)
• Insert Size (bp): 1239
• Entrez Gene: TERF1 (a.k.a. PIN2, TRBF1, TRF, TRF1, hTRF1-AS, t-TRF1)
• Promoter: CAG

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BsrGI-HF (not destroyed)
• 3′ cloning site: Bsu36I (destroyed during cloning)
• 5′ sequencing primer: TCAACACTTCAGCTACAACCAC
• 3′ sequencing primer: TCCATCATGTGGTTGTAGCTG

Resource Information

• Supplemental Documents:
  • pHZ031_3XHalo-GFP-TRF1 predicted.ape.ape
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • HaloTag Vector Limited Use Label License
• Industry Terms:
  • Not Available to Industry

Depositor Comments

TRF1 is from Roger Greenberg lab