SnFR-gamma8
(Plasmid
#165496)
-
PurposeGreen fluorescent glutamate reporter fused to TARP gamma-8 for mammalian expression.
-
Depositing Lab
-
Depositing OrganizationHumboldt-Universitaet zu Berlin
Located in Germany -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 165496 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 165496-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 165496-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepcDNA 3.1
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 5460
- Total vector size (bp) 8622
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameiGluSnFR extracellular domain fused to gamma-8 via NETO2 TM domain
-
Alt namecacng8
-
SpeciesR. norvegicus (rat), Synthetic
-
Insert Size (bp)3162
-
Entrez GeneCacng8
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BmgBI (unknown if destroyed)
- 3′ cloning site XbaI (not destroyed)
- 5′ sequencing primer AACCGTATTCCACTGCTGC
- 3′ sequencing primer CAACAGATGGCTGGCAACTA
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made bySusumu Tomita, Roger Nicoll, Lorin Looger
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Chimera of iGluSnFR (Addgene plasmid # 41732), Neto2 and Gamma-8.
Please visit https://doi.org/10.1101/2021.01.21.427382 for bioRxiv preprint.
DNA (Catalog # 165496-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 165496-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
SnFR-gamma8 was a gift from Andrew Plested (Addgene plasmid # 165496 ; http://n2t.net/addgene:165496 ; RRID:Addgene_165496) -
For your References section:
Targeted sensors for glutamatergic neurotransmission. Hao Y, Toulme E, Konig B, Rosenmund C, Plested AJR. Elife. 2023 Jan 9;12:e84029. doi: 10.7554/eLife.84029. 10.7554/eLife.84029 PubMed 36622100
Map uploaded by the depositor.
