AAV hSYN DIO mGluR1-myc-FLAG
(Plasmid #166227)

• Purpose: AAV expressing cre-dependent mGluR1-myc-FLAG
• Depositing Lab: Jason Aoto
• Publication: Cai et al Neuron. 2021 Apr 7;109(7):1137-1149.e5. doi: 10.1016/j.neuron.2021.01.028. Epub 2021 Feb 17.

Backbone

• Vector backbone: pAAV
• Backbone size w/o insert (bp): 4869
• Total vector size (bp): 7682
• Vector type: Mammalian Expression, AAV, Cre/Lox

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: metabotropic glutamate receptor 1
• Alt name: mGluR1
• Species: M. musculus (mouse)
• Insert Size (bp): 2808
• GenBank ID: NM_001114333
• Entrez Gene: Grm1 (a.k.a. 4930455H15Rik, Gm10828, Gprc1a, mGluR1, nmf373, rcw, wobl)
• Promoter: human Synapsin
• Tag / Fusion Protein:
  • Myc and FLAG (C terminal on insert)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: gcaccacgcgaggcgcgagat
• 3′ sequencing primer: caaccaggatttatacaagg

Resource Information

• Supplemental Documents:
  • AAV hSYN DIO mGluR1 MF.ape
• A portion of this plasmid was derived from a plasmid made by: Origene

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Original cDNA from origene (CAT: MR211136)