pcDNA3.1-SARS2-Spike-D614G
(Plasmid
#166850)
-
PurposeFor expression of SARS-CoV-2 Spike D614G in mammalian cells (C9 tagged at C-term)
-
Depositing Lab
-
Depositing OrganizationNew York Genome Center
Located in the United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 166850 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 * | |
| DNA | 166850-D50 | 50 μg of DNA in Tris buffer | $495 * | ||
| DNA | 166850-D100 | 100 μg of DNA in Tris buffer | $585 * | ||
* Log in to view industry pricing.
Backbone
-
Vector backbonepcDNA3.1
- Backbone size w/o insert (bp) 5500
- Total vector size (bp) 9300
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSARS-CoV-2 Spike
-
Alt namespike glycoprotein
-
SpeciesSARS-CoV-2 virus
-
Insert Size (bp)3819
-
GenBank ID43740568
-
Entrez GeneS (a.k.a. GU280_gp02, spike glycoprotein)
- Promoter CMV
-
Tag
/ Fusion Protein
- C9 (C terminal on insert)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer cgcaaatgggcggtaggcgtg
- 3′ sequencing primer ccagaatagaatgacacctac
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 166850-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 166850-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA3.1-SARS2-Spike-D614G was a gift from Neville Sanjana (Addgene plasmid # 166850 ; http://n2t.net/addgene:166850 ; RRID:Addgene_166850) -
For your References section:
The Spike D614G mutation increases SARS-CoV-2 infection of multiple human cell types. Daniloski Z, Jordan TX, Ilmain JK, Guo X, Bhabha G, tenOever BR, Sanjana NE. Elife. 2021 Feb 11;10. pii: 65365. doi: 10.7554/eLife.65365. 10.7554/eLife.65365 PubMed 33570490