pTJV1ScGm-rpoB
(Plasmid #166979)

• Purpose: Generates ssDNA in vivo targeting E. coli rpoB for recombineering w/ Beta recombinase; temp. sensitive pSC101 ori and sgRNA for Cas9 counterselection; aacC1 for gentamycin resistance
• Depositing Lab: Christopher Reisch
• Publication: Ellington et al Synth Biol (Oxf). 2022 May 3;7(1):ysac007. doi: 10.1093/synbio/ysac007. eCollection 2022.

Backbone

• Vector backbone: pTJV1Sc-rpoB
• Total vector size (bp): 5966
• Vector type: Bacterial Expression, CRISPR, Synthetic Biology

Growth in Bacteria

• Bacterial Resistance(s): Gentamicin, 10 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: gentamycin-3-acetyltransferase
• Insert Size (bp): 1067
• Entrez Gene: aac(3)-Ia (a.k.a. p165897_092)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: ggcggatcttcacctagatc
• 3′ sequencing primer: gagacgttgatcggcacg

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Same as pTJV1Sc-rpoB, but spectinomycin resistance marker changed to gentamycin resistance