pAAV-DIO-EF1α-mKate2-biPAC
(Plasmid #169127)

• Purpose: AAV plasmid containing a mKate2 and a light-gated adenylate cyclase biPAC
• Depositing Lab: Georg Nagel
• Publication: Zhang et al Nature. 2021 Sep;597(7875):245-249. doi: 10.1038/s41586-021-03845-0. Epub 2021 Aug 25.

Backbone

• Vector backbone: pAAV-DIO-EF1a
• Vector type: Mammalian Expression, AAV, Cre/Lox

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: mKate2-biPAC
• Species: Beggiatoa sp. IS2
• Insert Size (bp): 1806
• Mutation: codon optimized to mouse
• GenBank ID:
• Promoter: EF1a
• Tag / Fusion Protein:
  • mKate2 (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (not destroyed)
• 3′ cloning site: SpeI (not destroyed)
• 5′ sequencing primer: ccagaggttgattatcgataagc

Resource Information

• Supplemental Documents:
  • pAAV-DIO-EF1α-mKate2-biPAC.gb
• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Evrogen Limited Use Label License for FPs
• Industry Terms:
  • Not Available to Industry

Depositor Comments

the Boston Children's Hospital viral core made the AAVs for this plasmid, the virus can be requested there.