pFnCas12a_NT
(Plasmid #169838)

• Purpose: Expresses FnCas12a and guide RNA in Bacteria
• Depositing Lab: John van der Oost
• Publication: Mohanraju et al CRISPR J. 2021 Feb;4(1):82-91. doi: 10.1089/crispr.2020.0086. Epub 2021 Feb 4.

Backbone

• Vector backbone: pNW33n
• Backbone size w/o insert (bp): 4447
• Total vector size (bp): 8350
• Vector type: Bacterial Expression, CRISPR

Growth in Bacteria

• Bacterial Resistance(s): Chloramphenicol, 25 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: FnCas12a
• gRNA/shRNA sequence: Cas12a gRNA
• Species: Francisella tularensis subsp. novicida
• GenBank ID: WP_003040289.1
• Promoter: pXynA

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: GTTTGCAAGCAGCAGATTACG
• 3′ sequencing primer: TGCGGCTGTGAAAGAATTCC

Resource Information

• Supplemental Documents:
  • pFnCas12a_NT.gbk
• A portion of this plasmid was derived from a plasmid made by: The gene was cloned from pY002 (pFnCpf1_min) (Plasmid #69975).

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry