-
PurposeExpresses a T7 RNA Polymerase that produces long RNA transcripts in high yield and generates fewer abortive transcripts.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 174866 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepBR322
- Backbone size w/o insert (bp) 2706
- Total vector size (bp) 5427
-
Modifications to backboneUpstream lac promoter and operator are added as well as RBS
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsUse BL21(DE3) for protein expression
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameT7 RNA polymerase
-
SpeciesT7 bacteriophage
-
Insert Size (bp)2721
-
MutationP266L
- Promoter lac promoter
-
Tag
/ Fusion Protein
- 6XHis-tag (N terminal on insert)
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer CAGGAAACAGCTATGACCATG
- 3′ sequencing primer CGTTCTCGGAGCACTGTCCG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
An earlier reference about P266L :
A mutation in T7 RNA polymerase that facilitates promoter clearance (PMID: 15831591)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
p6XHis-T7(P266L) was a gift from Anna Pyle (Addgene plasmid # 174866 ; http://n2t.net/addgene:174866 ; RRID:Addgene_174866) -
For your References section:
Native Purification and Analysis of Long RNAs. Chillon I, Marcia M, Legiewicz M, Liu F, Somarowthu S, Pyle AM. Methods Enzymol. 2015;558:3-37. doi: 10.1016/bs.mie.2015.01.008. Epub 2015 Feb 27. 10.1016/bs.mie.2015.01.008 PubMed 26068736