Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
We will increase some of our prices at 12:00 AM ET on April 1, 2023. Be sure to complete your order before this time to take advantage of current prices. See the new prices and get more information or speak with our friendly support team.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pET-6xHis-SUMO-MarathonRT
(Plasmid #109029)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 109029 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    ChampionTM pET SUMO
  • Backbone manufacturer
    Invitrogen
  • Backbone size w/o insert (bp) 5643
  • Total vector size (bp) 6927
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    ERE_01490
  • Species
    Eubacterium rectale (Eu.re.I2)
  • Insert Size (bp)
    1284
  • GenBank ID
    CBK92290.1
  • Promoter T7
  • Tag / Fusion Protein
    • 6xHis-SUMO tag (N terminal on backbone)

Cloning Information

  • Cloning method TOPO Cloning
  • 5′ sequencing primer TTTGGACATGGAGGATAACG
  • 3′ sequencing primer TAAGTTGGCAGCATCACCCG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pET-6xHis-SUMO-MarathonRT was a gift from Anna Pyle (Addgene plasmid # 109029 ; http://n2t.net/addgene:109029 ; RRID:Addgene_109029)
  • For your References section:

    An ultraprocessive, accurate reverse transcriptase encoded by a metazoan group II intron. Zhao C, Liu F, Pyle AM. RNA. 2018 Feb;24(2):183-195. doi: 10.1261/rna.063479.117. Epub 2017 Nov 6. 10.1261/rna.063479.117 PubMed 29109157