Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pET_RTX
(Plasmid #102787)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 102787 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    reverse transcription xenopolymerase
  • Alt name
    RTX
  • Insert Size (bp)
    2328
  • Promoter T7 promoter + lac operator

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NdeI (unknown if destroyed)
  • 3′ cloning site BamHI (unknown if destroyed)
  • 5′ sequencing primer gatctcgatcccgcgaaattaatacg
  • 3′ sequencing primer gctcagcggtggcagc
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pET_RTX was a gift from Andrew Ellington (Addgene plasmid # 102787 ; http://n2t.net/addgene:102787 ; RRID:Addgene_102787)
  • For your References section:

    Synthetic evolutionary origin of a proofreading reverse transcriptase. Ellefson JW, Gollihar J, Shroff R, Shivram H, Iyer VR, Ellington AD. Science. 2016 Jun 24;352(6293):1590-3. doi: 10.1126/science.aaf5409. 10.1126/science.aaf5409 PubMed 27339990