pegCTNNB1 S45F
(Plasmid
#169843)
-
PurposepegRNA used for installation (via C•G-to-T•A) of the oncogenic S45F in Ctnnb1 in mouse liver.
-
Depositing Lab
-
Depositing OrganizationUniversity of Massachusetts, Worcester
Located in United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 169843 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 169843-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 169843-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepmd127
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namepegCTNNB1 S45F
-
gRNA/shRNA sequenceAGGGTTGCCCTTGCCACTCA
-
SpeciesM. musculus (mouse)
-
GenBank ID
-
Entrez GeneCtnnb1 (a.k.a. Bfc, Catnb, Mesc)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer HU6F
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2020.12.15.422970 for bioRxiv preprint.
DNA (Catalog # 169843-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 169843-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pegCTNNB1 S45F was a gift from Wen Xue (Addgene plasmid # 169843 ; http://n2t.net/addgene:169843 ; RRID:Addgene_169843) -
For your References section:
Improved prime editors enable pathogenic allele correction and cancer modelling in adult mice. Liu P, Liang SQ, Zheng C, Mintzer E, Zhao YG, Ponnienselvan K, Mir A, Sontheimer EJ, Gao G, Flotte TR, Wolfe SA, Xue W. Nat Commun. 2021 Apr 9;12(1):2121. doi: 10.1038/s41467-021-22295-w. 10.1038/s41467-021-22295-w PubMed 33837189