Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pegCTNNB1 S45del
(Plasmid #169844)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 169844 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pmd127
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    pegCTNNB1 S45DEL
  • gRNA/shRNA sequence
    AGGGTTGCCCTTGCCACTCA
  • Species
    M. musculus (mouse)
  • GenBank ID
  • Entrez Gene
    Ctnnb1 (a.k.a. Bfc, Catnb, Mesc)

Cloning Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://doi.org/10.1101/2020.12.15.422970 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pegCTNNB1 S45del was a gift from Wen Xue (Addgene plasmid # 169844 ; http://n2t.net/addgene:169844 ; RRID:Addgene_169844)
  • For your References section:

    Improved prime editors enable pathogenic allele correction and cancer modelling in adult mice. Liu P, Liang SQ, Zheng C, Mintzer E, Zhao YG, Ponnienselvan K, Mir A, Sontheimer EJ, Gao G, Flotte TR, Wolfe SA, Xue W. Nat Commun. 2021 Apr 9;12(1):2121. doi: 10.1038/s41467-021-22295-w. 10.1038/s41467-021-22295-w PubMed 33837189